EST details — SGN-E257760

Search information 
Request: 257760Match: SGN-E257760
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C36620Clone name: cLEG-39-H20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C181021 is on microarray TOM1: SGN-S1-1-6.3.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181021 [TUS-35-O3] Trace: SGN-T187521 EST: SGN-E375753 Direction: 3' Facility: INRA
Clone: SGN-C181021 [TUS-35-O3] Trace: SGN-T187522 EST: SGN-E375754 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E257760Length: 478 bp (1030 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E257760 [] (trimmed) CCACACCAGCACCAACACCAACACCCACAATTTGTCAGGCCAATGGCCGGACCACCGGGTCAAGGGTACTACGCCGTACAGAGGATGCCACAGGA
GCCTTACAGGGATCAACCAGTTTACAATGTCATGCCTAGTTTACCACAAGCAGTACCGACAGTTGCAGCGGCACCACCAACTTTACAATCTCAGG
TACCTCCAAAGGTGGCTGGTTATTCGGAAGGATATGGCATGGTAAGACCCGCAACTACCATGGGAGTTGGTGTAGCAGATGCAGGTGGGTACACA
CAGATGGCGTACGATGGTGGAGTAGGAAGGCAGATGTACTATCCTCCCCAAGGTGGTGTCATAGCGCCACCACAACAACAACCGCAGTACCACGC
AATGCCGCCACAAGCTGTTGTTGGCTCCGATATGAGACCTCAAGAAGCTGCTAAAGTCGTACCTGTGAAACCTACACAAACATCAGTGTGATTGA
TCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E257760] SGN-U562986 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71446 [Download] [View] Facility Assigned ID: TBFFZ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0094 Quality Trim Threshold: 12.5