Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E257839

Search information 
Request: 257839Match: SGN-E257839
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C36710Clone name: cLEG-39-M2
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E257839Length: 461 bp (1059 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E257839 [] (trimmed) ATAAATTATATTACATTGCTTAGAAACGTGAAAGTATTTAACTCAAACATTTGCTTCAAATTCAAAGGTACAATCTGCAGAAGTATAAATAGTAA
TAATAGATAACATTATTATTCTTATTCTTAGATCTTGTAACGGGACAATGCAGAAGTTCCATCTAGGCCTCTGTTATGGAGGTAACTAGTGTGGT
CTTTCACTGTGGTTGCGCGATATTTTGGAGGATTATCTTCTGATAACAATTCAGTTATCGGTCCATAAAGCTTGGAAGATTGATATGGACTTTCA
CCGAAGAAGCACGTGATTGACATTCTTGATCCAACATTGTTTGAGATTGCTCTGTGCTCGACACTTAAGTACTTGTCATTTGACAAGAGCTGCAA
AAAATAATTAAAAAAAAGATTTTCTGCAGAAAATCTCCAATATTCACCACTAGAGAACCGGGTGTAGGAGGAACATCAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E257839] SGN-U580097 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71525 [Download] [View] Facility Assigned ID: TBFFX73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5