EST details — SGN-E258311
| Search information |
| Request: 258311 | Match: SGN-E258311 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C39208 | Clone name: cLEG-49-B15 |
| ||
| Library Name: cLEG | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: breaker fruit
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C188341 [TUS-54-P3] | Trace: SGN-T351926 | EST: SGN-E551051 | Direction: 5' | Facility: Giovanni |
| Sequence |
| Sequence Id: SGN-E258311 | Length: 251 bp (984 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E258311 [] (trimmed)
GTTTTCCGCTCTGCTAAGGTCCGTATTGCTGTATTTAGTCAGCATCATGTTGATGGGCTGGATCTGTCCTCAAATCCCCTCTTATACATGATGCG
TTGCTTTCCAGGAGTGCCTGAACAAAAATTACGTGGTCATCTAGGTTCATTTGGTATAACCGGAAATCTTGCTCTTCAGCCCATGTACACTTTAT
CTGGTGGGCAAAAAAAGCAGAATTGCATTTGCCAAGATAACTTTCCAGAAAACTCCCATAT
TTGCTTTCCAGGAGTGCCTGAACAAAAATTACGTGGTCATCTAGGTTCATTTGGTATAACCGGAAATCTTGCTCTTCAGCCCATGTACACTTTAT
CTGGTGGGCAAAAAAAGCAGAATTGCATTTGCCAAGATAACTTTCCAGAAAACTCCCATAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E258311] | SGN-U566380 | Tomato 200607 | Build 2 | 58 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T74183 [Download] [View] | Facility Assigned ID: TBFHM08TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.967 | Expected Error Rate: 0.0125 | Quality Trim Threshold: 14.5 |
Working
