EST details — SGN-E258683

Search information 
Request: 258683Match: SGN-E258683
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C39744Clone name: cLEG-50-H9
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188370 [TUS-55-A8] Trace: SGN-T351941 EST: SGN-E551066 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258683Length: 400 bp (885 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E258683 [] (trimmed) TTTGCGCAATGTGTGGTAATAGGGGAATGCAAAAATATGTAAATCACGTTTTCCATGAGATGAAAAGCTGTGGTTTTGAGCCTGATAGAGACACA
TTTAATACTTTGATTCGTGCTTATGGAAGGTGTGATTCTGATTTTAATGCTGCAAAGATGTACGATGAGATGATCCAATCAGGATTCACTCCGTG
TGTCACAACATACAATGCGCTTCTTAATGCCCTTGCTCGTCGAGGTGATTGGAGAGCAGCTGAATCTGTTTTCTCAGACATGAAAAGTAAGGGCT
TTAAGCCCAGTGAAACTACTTACTCTTTGATGCTCCACTGCTATTCCAAGGGAGGGAACGTGAGAAGTGTGGAGAGAATCGCAAAGGAAATTTAT
GATGGTCCTATTTTTCCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258683] SGN-U568800 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T74311 [Download] [View] Facility Assigned ID: TBFHQ41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0167 Quality Trim Threshold: 14.5