Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E258690

Search information 
Request: 258690Match: SGN-E258690
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C39795Clone name: cLEG-50-L5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
See unigene SGN-U565313 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258690Length: 512 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E258690 [] (trimmed) AGATTAAAACAGTTCTCATGCATACCATCAGAAGCTGAGTGGCGAAAAAGGGATTTTGTCCCACCTTCAGATTGGCCGAACCATGGCAATGTTGA
GCTTGAAGACTTACAAGTTAGGTATCGTCCAAATACTCCTCTAGTGCTTAAAGGAATTACTCTCAACATTAGAGGGGGAGAGAAGATCGGTGTTG
TTGGTCGTACTGGAGGTGGAAAATCAACACTTATTCAAGTTTTCTTCCGTTTGGTGGAGCCTGCAGCTGGAAGAATAGTCATTGACGGCATTGAC
ATATCCAGGCTCGGGCTTCATGATCTTAGATCTCGCTTTGGGATCATTCCTCAAGAACCAGTTCTTTTTGAAGGAACTGTGAGAAGCAACATTGA
CCCCATTGGACAATATTCAGATGATGAAATTTGGAAGAGCCTCGATCGCTGCCAACTGAAAGAAGTGGTGTCTTCAAAACCCGAAAAGCTTGACT
CACCAGTTGTTGATAATGGAGACAACTGGAGTGTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258690] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T74318 [Download] [View] Facility Assigned ID: TBFHQ63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5