EST details — SGN-E258844

Search information 
Request: 258844Match: SGN-E258844
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37174Clone name: cLEG-41-E19
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177320 is on microarray TOM1: SGN-S1-1-3.4.6.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258844Length: 404 bp (901 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E258844 [] (trimmed) GGCGGTTAGTGGTATTATATATATAGAGAGAATTCGAAGAGAGGCAGAGAAGTGTTTTATCTTCCTTAATTTTCTCTTTCCACCCATTCAGATCT
GAGAGAGAGAAATTGTATTTTGAAGAAGAAAGAAAAAGAAAGGGTAATTCAATAGAATTTTGGTTCCAATGTCGGTGGTATCGTCATTAGCAAAG
TATAAGCTGGTGTTTTTGGGAGATCAATCTGTGGGCAAAACCAGTATAATTACTCGTTTTATGTACGATAAATTTGACACCACTTATCAGGCTAC
GATTGGTATTGATTTTTTATCAAAGACAATGTACCTTGAAGATCGAACAGTTCGCCTGCAGCTCTGGGATACTGCTGGTCAAGAAAGATTTAGAA
GTCTTATTCCAAGCTACATTAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258844] SGN-U580744 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71876 [Download] [View] Facility Assigned ID: TBFGE34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5