EST details — SGN-E259055

Search information 
Request: 259055Match: SGN-E259055
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37130Clone name: cLEG-41-C14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177303 is on microarray TOM1: SGN-S1-1-4.4.7.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177303 [TUS-26-D5] Trace: SGN-T182471 EST: SGN-E369857 Direction: 3' Facility: INRA
Clone: SGN-C177303 [TUS-26-D5] Trace: SGN-T182472 EST: SGN-E369858 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259055Length: 369 bp (881 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259055 [] (trimmed) GATATTGATGATGTACCATCGACATATTTTGTTGTGGTCGTTGCTGCTGCTGCATCATGTATTGTTGTTGTTGCATCATTTGATATTGTTGTTGT
TGTTGCATCATTTGGTATTGTTGTTGTTGCTGCGCCATCATTTGTACGCTTGTTGGAGGGGCTATGTGGTTTGACATTGCAAAAGGGTCATTGTG
ATTGACTGAACTCTGTCCAGGTGGAACGATTGCTAGAGCCAATGCATTGCTTTCCTCTAATTCTGCAACTCTTGGATCCACTTCATTCAAGCCCT
GTCCACAGAGATGAAAAATATTCTGATCAAGACTATTATTTCACACGAAAGAAGGAGACACGAGCCATGAACAAAGATTTCGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259055] SGN-U568053 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72087 [Download] [View] Facility Assigned ID: TBFGF19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5