EST details — SGN-E259204

Search information 
Request: 259204Match: SGN-E259204
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37836Clone name: cLEG-43-E6
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259204Length: 620 bp (906 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E259204 [] (trimmed) CGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTACCAATGAGTTAGAAGT
GAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGTTGAGTGAAGCATATGATAGGTGTGGTGAAGTATGTGCAGAGTATGCAAAGACGTTTA
ACTTAGGAACTATGCTAATGACTCCCGAGAGAAGAAGGGCTATCTGGGCAATATATGTATGGTGCAGAAGAACAGATGAACTTGTTGATGGCCCA
AACGCATCATATATTACCCCGGCAGCCTTATATAGGTGGGAAAATAGGCTAGAAGATGTTTTCAATGGGCGGCCATTTGACATGCTCGATGGTGC
TTTGTCCGATACAGTTTCTAACTTTCCAGTTGATATTCAGCCATTCAGAGATATGATTGAAGGAATGCGTATGGACTTGAGAAAATCGAGATACA
AAAACTTCGACGAACTATACCTTTATTGTTATTATGTTGCTGGTACGGTTGGGTTGATGAGTGTTCCAATTATGGGTATCGCCCCTGAATCAAAG
GCAACAACAGAGAGCGTATATAATGCTGCTTTGGCTCTGGGGATCGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259204] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72566 [Download] [View] Facility Assigned ID: TBFGN27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5