Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E259519

Search information 
Request: 259519Match: SGN-E259519
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37710Clone name: cLEG-42-O12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
See unigene SGN-U585837 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259519Length: 223 bp (1055 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E259519 [] (trimmed) TTGGAGGAGTTTGATGGTGCTTTTGGCAAGTAACAATTCATTTTCAGGCCTGATTCCAGTGGAATTGACTAGCCTTTCTCAGATCACTCAGCTAG
AGCTTGATGGTAATTCGTTATCTGGAGAACTTCCAGCCGATCTAATATCGTGGCACTCTTTGACAATATTGGATCTTTCCAAGAACAAACTCTCT
GGCCAGATTCCAGCTGCTCTAGGAATAATCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259519] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72280 [Download] [View] Facility Assigned ID: TBFGJ90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5