EST details — SGN-E259742

Search information 
Request: 259742Match: SGN-E259742
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37483Clone name: cLEG-42-D16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177459 is on microarray TOM1: SGN-S1-1-8.2.6.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177459 [TUS-26-J17] Trace: SGN-T182582 EST: SGN-E369968 Direction: 3' Facility: INRA
Clone: SGN-C177459 [TUS-26-J17] Trace: SGN-T182583 EST: SGN-E369969 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259742Length: 506 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259742 [] (trimmed) GTAAGATCTCAAGGTCAGCTCAGAAGCTCTCTATAGTCGCCAACCGCTGCTTAGTCAGACATGCAAAGACACGTCCAAAAATGAGCGAAGTCCTG
GAAATGGTGAACAAAGTTGTCGAGACATCAACAGGAATAGGAAACCCTGGACCACCTGTGAGAATCGCGGAACCAACTTCACCAGAATCTACAAG
GAAAGGTAAGAGGAAGGTAGACACCAAACTCGGAGATGGTAGCCGGTTAGTACGTATATGGTCAACAAAGCTTACAAACACTTGTTAATACAATA
GTTTCCAATATGCACAAAGAGAAAACAGAGTTGAAAAGGTAATGAAGAAGCACAGATTATATAACTAGTTCCCAATATGAATGAGGTCTTCTCCA
TTATTGTCTTATATTTATATATAATATAGATGTTTAAATTTATAGAGAAAATCGTAATCATTCAAATGTACATTCAAATTTAGACGTGTTTAACA
AATGAGGCATAAGTGTTGCTATTTGTATGAN
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259742] SGN-U569083 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72503 [Download] [View] Facility Assigned ID: TBFGL20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0067 Quality Trim Threshold: 12.5