EST details — SGN-E260673

Search information 
Request: 260673Match: SGN-E260673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C40616Clone name: cLEG-54-I16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188444 [TUS-55-D10] Trace: SGN-T351964 EST: SGN-E551089 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E260673Length: 780 bp (861 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E260673 [] (trimmed) TTGAGGTTAGAAATGTTGAAAATAAGAAAAATGACACGAGTCGTGTTAAGTCTGATGAGGTATCCGATGGGGAGAGGAACTATACTGACGAACAT
GTGCAGTTGATTAGGCAAATTAAGATTAAGAAGGACTATTACGCGATTCTTGGTCTAGAGAAGGGTTGTTCAGTTGAGGAGATTAGGAAGTCGTA
CAGGAAACTGTCATTGAAAGTTCATCCCGACAAAAATAAGGCTCCAGGCTCTGAAGAGGCATTTAAGAAAGTATCCAAGGCATTTAAGTGTTTGA
GTGATGATGATTCAAGGAGGCAGTATGACCAGACAGGTTTGGCTGAGGATTTCGAGTATAATCAGCAGCATAATGTCAGGCGCAGGAGGAGAACT
GGGCACAGCTATTATGATGATGATTTTGATCCTGATGAGATTTTCAGAGCGTTTTTTGGGCGTTCCGATATGTTTAGGACAGCTCATGTTTACAG
GACAAGAACAAATGCTGCTCCCCAGAGAGAGGATTTAGGTTCCACTGGGCCCAACTTCCTTCTCCTCCTTCAGTTATTGCCATTTTTAATCATCA
TTTTACTTGCTTATCTTCCTTTCTCGGAGCCAGAGTATTCTTTGCAGAAGAACTACCAATATCAGTTTAGGAAGATGACCGAAGAACATGGAGTA
GAATATTTTGTTAAATCACATGAATTTGATCAGAAGTATCCTCTTGGTAGTCCTGATCGAGATACATTGAAGAACATGTTATTAGGGATTACAAA
AATATGCTTGGTCGTTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E260673] SGN-U573210 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T75291 [Download] [View] Facility Assigned ID: TBFIF56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5