Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E261386

Search information 
Request: 261386Match: SGN-E261386
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C41563Clone name: cLEG-57-K14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188512 [TUS-55-G6] Trace: SGN-T352011 EST: SGN-E551136 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E261386Length: 822 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E261386 [] (trimmed) TTTTTTTTTAACAAGAAACAAGTGCAACAAACATTGTATTTAAATCAATAATACTATACAATATAATACAATACAACACAACACACAAGACAATA
CAATACAATACTCTTTATTTGGAACAAAGAGTTTATTTGGTTGGGAATAACAAGTAACACAAGCACAACAAACTGATTGAATAATAAGTTCTATA
TAGACACACTGTTGGGAATGAAACAATTCCGTCCACTGCAATGCTGAATTCAACAGTGGAGATTTTTGAGCAACGTTTTATGACTGGTGCGGGCA
AAAACCTTCCTGAACATGCAATGATTTGCATGATAAATCGTGAAGAGTCAGTCATGAGCGAGCTGTGCTTAGACGCCCCTGCCGTGGATGATCCG
GACAAGTTATTCGCTAATACATTGTTTGAGGTTGTATTCAATGAGAGCCGGAATTTGCCATTCATTTTGTTCGTGAAAGATGCTGACAAAGTAAT
GGCAGGAAACGCAGAATTATATTCAACATTTAAAACTCGGCTTGAGAAACTTCTTAATAATGTAATTATTATTGGTTCACAGTCGGCTTGAGAAG
CTTCCTGATAATGTAATTAGTATTGGTTCACAATAGCTTGAGAAGCTTTCTGATAATGTAATTATTATTGGTTTACAATTGGCTTGAGAAGCTTC
CTGATAATGTAATTACTATTGGTTCACAGTCTGCTTGAGAAGCTTCCTGATAATGTAATTACTATATGTTCACAGTCGGCTTGAGAAGCTTCCTG
ATAATGTAATTTCTATTGGTTCACAGTCGGCTTGAAAGCTTCCCGATATGTAATTACTAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E261386] SGN-U579694 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T76048 [Download] [View] Facility Assigned ID: TBFIR67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5