EST details — SGN-E261500

Search information 
Request: 261500Match: SGN-E261500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C41598Clone name: cLEG-57-M11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188514 [TUS-55-G8] Trace: SGN-T352012 EST: SGN-E551137 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E261500Length: 761 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E261500 [] (trimmed) CAACAACAACATGCATTAGCATATCGGCGGCCAATGAGCAGCCTCTAGATCCCAGTCGTGGTTCCTCTCATACTGGAGAAGAGATTGACGAATCA
AGCCATGGTCAAGAAGAAGCTTTTCTCTGGGAGTTGTTTGGTATTTTCAAGTATTTCCCAGGTGTTGTTTGGGTGATCCTGCTTGTCACTGCCCT
GACATGGATTGGATGGTTTCCATTTCTTTTGTTCGATACTGACTGGTTTGGTCGAGAAATTTATGGCGGTGAACCAAATGACGGAAAGAATTATA
GTGCAGGAGTGCGGATGGGTTCATTGGGTCTAATGTTGAATTCTGTCCTTCTTGGACTAACTTCATTGTTCATGGAGAAGCTCTGTCGAAAATGG
GGGGCTGGTTTCACATGGGGAGTTTCTAACGTGGTCATGTCTCTCTGCTTTATAGCCATGCTTATAATTACTGCTGTTAGGAGTAACATAGACAT
TGGCCAGGGTCTTCCGCCGGATGGAATTGTGATTGCTGCGCTGGTTGTATTTTCTATTCTTGGGATCCCACTAGCTATAACGTACAGTGTTCCAT
ATGCTTTAGTATCCTCAAGGATTGAAGCTCTTGGGCTTGGACAAGGCTTGTCAATGGGCGTGCTGAACCTGGCAATTGTGTTCCCACAGATTGTG
GTTTCACTGGGAAGTGGGCCATGGGATGAGCTATTTGGTGGAGGCAATTCACCAGCCTTTGTTGTGGCTGCGCTTTCAGCATTTGCTGCTGGACT
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E261500] SGN-U585171 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T76162 [Download] [View] Facility Assigned ID: TBFIQ78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5