Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E261795

Search information 
Request: 261795Match: SGN-E261795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C42876Clone name: cLEG-61-K5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188588 [TUS-55-J10] Trace: SGN-T352036 EST: SGN-E551161 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E261795Length: 769 bp (846 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E261795 [] (trimmed) CTAAACCCCTAAACCCCAAAATCTGAAACCCTAACAGCCATGGCAGCACTTCGCAGCAAGCTCCGATTTATCACCTCTCAGCATCACCACCACCT
CCGCCGTTACTCCGCCGCCTCTATCCTTAATCCCGATTCTAAATCTCCACTCTCAGGCAAAGACAAGTCACGCGCCGCCCTAACTCTCCTCAAAT
CCGAAACCGACCCACAGCGGATCCTCGACATCTGCCGTGCAGCTGCCTTAACCCCTGAATCCCATCTCGATCGCATTGCATATTCCAAAGCCATT
TCCAAGCTCAAAGATCTCAATCATTTCTCCGGTATCCGTTCATTTCTCCAGGAATCAACGACCCGGCCTGATTTGAAATCCGAGCGGTTCATTTC
CCATTTCATTGTTCTTTACGGTCAGGCCGGACTGCTTGATGAGGCTAAGAGGACTTTTGAGGAGATGGAGAAAATGGGCATTCAACGTACTGAGA
GAACTCTGAATGCGTTGTTGTTTGCTTGTGTTTTAGCTAAGAATTATGCTGAAATGAAAAGGGTATTCGTCGAATACCCAAAAAAGTATGGGTTT
GTTCCTAACTTAGATACCTACAATGTGGTGATCAAAGGGTTCTGTGAATCAGGTTCTGCTAGTTCAGTTTATTCGATATTGGATGAAATGAAAAG
AAACAATGTTAAGCCGAATGCAGAGTCTTTTGGGAATTGTATATCCGGGTTTTATAAGGAGGAGAAGTATGAAGATGTTGGGAAAATGGTGGAAA
TGATGAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E261795] SGN-U574746 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T77385 [Download] [View] Facility Assigned ID: TBFJG63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5