EST details — SGN-E262178

Search information 
Request: 262178Match: SGN-E262178
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C41772Clone name: cLEG-58-F6
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E262178Length: 384 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E262178 [] (trimmed) TACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCACTCTGCTCTCTGACGCAGTTCCAGTTGTCTTGACAGAGCCACCTATTGAAGAGCAATTGGCA
TGGCATACTCTATGGCCTGAATCACACAAACTTTATGGTCATGGGAATGAGCTTTTTTCTCTATGTTGTGATCATGATGGAAAGCTTGTAGCTTC
ATCCTGCAAGGCACAATCAGCACCGGTTGCTGAAATATGGCTTTGGCAAGTTGGTTCTTGGAAATCCGATGGTCGTTTACAGTCTCACAGTTTAA
CAGTGACCCCAATGGAGTTCTCTCATGATAACAAGTATCTCTTGGCTGTTTCAAGAGATCGCCACTTCTCTGTTTTTCAAATTAATCATTAAGGG
ACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E262178] SGN-U564169 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T76551 [Download] [View] Facility Assigned ID: TBFIX27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0