EST details — SGN-E262356

Search information 
Request: 262356Match: SGN-E262356
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C41078Clone name: cLEG-56-A3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188478 [TUS-55-E20] Trace: SGN-T352236 EST: SGN-E551361 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E262356Length: 734 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E262356 [] (trimmed) AAATTCGATCTTCAGAGTACTGAATCATCACAAAGGAAGATTCTACGATAAGGGTTGTTCAGATCGGTGTTTGTAAAACATCTGTTCTATTTTCT
TATAGAAACTAAACATGCCTAAGGAGAGAAGAGATAGGTCTGTTTCTTTTGATAGGAGCAGAGCTTCTCCTTACTGTTGTAGCTCGAGTCACTCA
AGGTCATCATTGTCCAAAAACCCTTTGGAAAATGAGGAAAATGTGAAGGACTGGGAAGATGCTCGATGCCCAGTGTGTATGGAACATCCTCATAA
TGCTATTCTCCTTCTGTGTGCCTCTCATGAGAAGGGCTGTCGTCCTTTTATGTGTGACACAAGTTATAGGCATTCAAATTGTTTTGATCAGTTCA
AAAAGTCATTTGAAGAAGCTTCAGCATCAACAACTCAGCAAGTGGAGATTCCAGCTTCAGCTTCTATTACGGAATCTACTGTAACGTTATCAGAA
GCTCTGTCTGAACTTCCAGGTGAAAGGACCGAAGGTGGTTCTATATCCCTAGATGCCTTGTCTTGCGAGAACCATGAAATAAAGAAGATGCTATG
CCCTCTCTGCCGTGGCCAGATAAATGATTGGATTGTTGTAGACTCTGCCCGTCGTCACATGAATGCCNAATTAAGAAGCTGCTCTAGCGAGACAT
GCGAGTTCAGTGGCACATATACAGATTTGCGTAAGCATGCTAGGCANGAGCATCCTCTTGTACGTCCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E262356] SGN-U569293 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T75828 [Download] [View] Facility Assigned ID: TBFIM02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5