EST details — SGN-E263977

Search information 
Request: 263977Match: SGN-E263977
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C43665Clone name: cLEG-64-F11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188632 [TUS-55-L6] Trace: SGN-T352254 EST: SGN-E551379 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E263977Length: 766 bp (890 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E263977 [] (trimmed) GGAGATTGTCATACTGCAATGACATACATATCCAAAATCATTGAGCATGAAATTATACTGAGGGACTCAAGTCGCTTTCATCATATCAAGAATGG
ATCTTGCTCTTGTAGAGGGTTTTGGTAGTAAGTTTTGTTATGGTGGAACATTTGCATGGTATACAAAAAGAAGGCCTCTTGAAAATGAAGTAAAA
GTTCATAAACAAACCACTGGACAGTGAGATTTGCAACACTTCTGCTTTTCAGAAGAGTGACACAGTGAGTGCAAGAACATGGAAACAAGAGTACA
GAGTGGGGCATTTTCTTTTTAATGAACCAAGAACTAGTCCTGCAGATTGGGTTTTAAACATATTATTCATAAGGATCATTCTGCAAGTGAGGCCC
AGAATTGCAGCATAATATTCTATTTCCTTCCAGTTTACCACAATTGGATGTGCTGAAAGTTTGCAATGCAAAGAAGGTAATGTAAAGAAGCTTTA
AGATAGTGCCTAATAAGGTGAGAAGTTATTCATATTTGTGCACTATTTTTCTCAATACTTCATCTGCCAACTTCACTGAATACAACTATACTTGG
ATATTCGCATCATTCTGTGATGTTATAATGTTGGGGCAGACATCAGAACGAGCTTTTCTTTGTGGGAATGCTTAATTAGAGCTTACGGTGATGAA
ATTACCAAACTGAAATGGTCAATTAGAATACTTTTGAGATCCTCGCTGGAAATGTATAAGAGAAAACAGATTTTTTCGTTTCTCAAAGTTATTGT
CACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E263977] SGN-U576364 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T78188 [Download] [View] Facility Assigned ID: TBFJU30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5