EST details — SGN-E264147

Search information 
Request: 264147Match: SGN-E264147
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C43716Clone name: cLEG-64-H23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188636 [TUS-55-L10] Trace: SGN-T352058 EST: SGN-E551183 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E264147Length: 368 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E264147 [] (trimmed) GTACACTTGGGTATTGTGAGGGAACTCTTGGCCATGTGGCCTGAACTTTGTAAATTATGCTACTCCTCAAACACGAGCCCTCTTTATTCATCTGC
CTTCAAGGGACATTTGGACGTGGTGAATGCCATTTTAGATGCAGATGTGACCTCCATACGAATTGTTAGGAAAAATGGAATAACTGCCCTGCACA
CAACTGCTAGAGTATGGCCTACTGCATATTGTGAAAGCACTTATAGAGATAGATCCAGATATAATATCTATCAAAGATAAAAAGGGCCAAACCGC
ACTTCATATGGCTGCTAACGGTCAGGATACCTTTGTAGTGGAAGAAATGCTGGATACTGACAGCTCGATATTGAATGAGCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E264147] SGN-U563103 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T78358 [Download] [View] Facility Assigned ID: TBFJU48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0250 Quality Trim Threshold: 14.5