EST details — SGN-E265075

Search information 
Request: 265075Match: SGN-E265075
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47937Clone name: cLEI-2-N11
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188754 [TUS-56-A8] Trace: SGN-T338298 EST: SGN-E537423 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188754 [TUS-56-A8] Trace: SGN-T338301 EST: SGN-E537426 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265075Length: 532 bp (727 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E265075 [] (trimmed) TGTTCTTTCTTGAATTTCATTATATATAATGGCAAGCAGACGATCACGTTCCAGAATAAGCGATGATCAAATCGCTGATCTTGTTTCCAAGTTGC
AACAACTTATCCCTGAAATTCGTAATAGACGTTCTGACAAGGTTTCAGCTTCAAAAGTGCTTCAAGAAACTTGCAACTATATAAGAAATTTACAC
AGAGAAGTGGATGGATTAAGTGAGAGATTATCACAACTTTTGGAATCAACTGATAGTGATAGTGCTCAAGCTGCTATTATTAGAAGCTTACTTAT
GTAGTAGCTATTTAATTAAATAGCTCAAACTTCATTAAAATTTCTATTATTAAAAAAAGATGGAGCATTTATATTATTAATTAGGGTTTTTTTGG
CCACTATAGGTCAAAATTAATTTCTATTTTTCTGTTTTCCAATTTTGAATAGTTCTTTTTTTTTCTTTTACTTTGTGTTGTATTGTTGTATCCAT
CTGTTTTAAGAGCTGATGTTTCTTTGATCTCAGCCTTTNTTAAGTATATAAGTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265075] SGN-U568309 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T79689 [Download] [View] Facility Assigned ID: TGSAG78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0097 Quality Trim Threshold: 12.5