EST details — SGN-E265478

Search information 
Request: 265478Match: SGN-E265478
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49861Clone name: cLEI-9-N6
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189027 [TUS-56-L17] Trace: SGN-T338766 EST: SGN-E537891 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189027 [TUS-56-L17] Trace: SGN-T338769 EST: SGN-E537894 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265478Length: 585 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E265478 [] (trimmed) TCTTGTGTGAATAATAAAAATTTGATCATTTTATTTCGTATGGATCATCAAAAATTAGGCACCACCAATATTATGAGTCCTCCATCAGTCCCAAA
TCACTATAAAAAATTTCATGATCAAGAAAAGAGACATGATTTTCAAACTCAACAACCTTACCTTGTGTATTCCCCTGTTGTTAAGCCTAACAACA
ATCCAATTGACTCTGTTTCTCATGTCTTCAATTCTTGGACTAACAAAGCTGACACTATGGCCCGTAACGTCTGGCGTAACTTGAAAACTGGTCCA
TCAGTATCAGAAGCAGCATGTGGTAAACTCAAATTGACAGCCAAGGCATTGACAGAAGGTGGATTTGAACCACTTTACAAGCAGATTTTTGCAAC
AGATCCAAATGAACAGTTGAAGAAGACATTTGCTTGTTATCTTTCTACAATAACTGGTCCTGTTGCTGGAACTCTTTATTTGTCATCAACCAAAC
TGGCCTTTTGTAGTGATCGTCCCTTATCTTTTCGAGCTCCATCGGGACACGAAGCTTGGAGCTACTATAAGGTGGCAATACCATTGGCAAACATT
GGAAGTGTCAATCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265478] SGN-U569382 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81759 [Download] [View] Facility Assigned ID: TGSBJ75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5