Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E265549

Search information 
Request: 265549Match: SGN-E265549
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47042Clone name: cLEI-14-L9
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
See unigene SGN-U585837 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265549Length: 539 bp (587 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E265549 [] (trimmed) GGGAGTGATAGGAAAGTAAACTACATTCTGGAGAGGGAATTCTTGGCTGAGGTTCAGATATTGGGATCAATTAGACATTCCAATATAGTGAAGTT
ATTGTGTTGTATATCAAGCGAGGATTCAAAGTTGCTCGTTTACGAGTACATGGTAAATCACAGTCTTGATAGATGGCTTCATGGGAAGAAGAGAG
TTTCCTTGAGTAATAAAGTCATGGATTGGCCAAAAAGATTGGAGGTTGCCATTGGAGCTGCTCAAGGACTTTGTTATATGCACCATGACTGCACT
CCACCGATCATTCATCGCGATGTAAAATCAAGCAATATCTTGTTGGATTCTGATTTCACAGCCAAAATAGCTGATTTTGGGTTAGCCAAGATTTT
AGAGAAGAAAGGAGAGCTTAACACCATGTCTGCTGTTGCGGGTTCCTTTGGTTACATAGCACCAGAGTATGCTTATACAACGAAAGTGAATGAGA
AGATTGATATCTATAGCTTTGGGGTGGTGCTATTGGAACTAGTGACAGGAAGACAACCAAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265549] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82759 [Download] [View] Facility Assigned ID: TGSCC65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5