EST details — SGN-E266086

Search information 
Request: 266086Match: SGN-E266086
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48969Clone name: cLEI-6-I22
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188905 [TUS-56-G15] Trace: SGN-T338557 EST: SGN-E537682 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188905 [TUS-56-G15] Trace: SGN-T338559 EST: SGN-E537684 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266086Length: 486 bp (850 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E266086 [] (trimmed) CACTGTACCACAAGAAGTTTTATATCTTGGAAGTTATTCAGAGACAATTAAGGACTTAAATTTGACACAATATATAATTCATAGACACACAACAT
GAACATCAACATAATGATAATGGATATTTTACAACATAGTGATCATCGATCCCTCACACATTCCGCAATTTAGGAATAACAAGAAGTGAATCTTT
CTTAAACATGGTGACATCCAATACCTCATCCATGTTAATCTTAGCTGGATCTATTTGATTTGGCAAAATCCAATCGAACTTATGGATCAATGAAG
CAACAGCTAACGGAATAAACCTCGAAGCCAAGGGTTCTCCAGCACATATTCTTCTCCCCGAACCAAAAGGAATATACTCAAACTTTTGCCCTTTG
TTGTCGAATTTTGAATTGATAAATCTTTCAGGTTTAAAGCTCGAAGGATCGTCCCAAATCTTAGAATCCCTTGCAATTGCCCACATATTAACCAA
CACTTGAGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266086] SGN-U585949 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80872 [Download] [View] Facility Assigned ID: TGSAV59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5