EST details — SGN-E266203

Search information 
Request: 266203Match: SGN-E266203
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47996Clone name: cLEI-3-A4
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
See unigene SGN-U582186 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266203Length: 503 bp (876 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E266203 [] (trimmed) GTTTGGTAATGTAAATGCACCTTATGAAGAGGGCAACATGCTGTCACAAGTGGATGTTGCGTGAAAGGATAAATGCTATAGAAATGGACATGATG
AGGAATGGCATTCCGCACAGTCATCTGTCGTTGAGGAATGTGTTGAAAGCGCTTGGAACAGAAGGGATGGTAAAGGAGCTGATTCAATATTTACG
TGCTGCAGAGAATCGGTTTTCTCGTTATGACACCTATATGATAACACCTGTCTATAATACAGCTTTACACTCCCTTATTGAGGCTAAAGAGAGTA
AAGTGGCAACACAGATATTCAAATCAATGGTGTCTTCTGGTGTTACACCTGATGCTGCAACATATAATATCATGATTGACGGCTGTAGCATTGTT
GGATGTTTCAGATCTGCACTTACCCTGATCTCTATGATGTTCCGCACTGGTTTCAACCCTCAAGCAGTGACTTTAACTGGCCTGTTAAAGATATT
GTTGAGATCTGAGGACTTTGATGGAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266203] SGN-U582186 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T79891 [Download] [View] Facility Assigned ID: TGSAJ02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5