EST details — SGN-E266474

Search information 
Request: 266474Match: SGN-E266474
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48591Clone name: cLEI-5-C13
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188853 [TUS-56-E11] Trace: SGN-T338470 EST: SGN-E537595 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C188853 [TUS-56-E11] Trace: SGN-T348792 EST: SGN-E547917 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266474Length: 494 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E266474 [] (trimmed) GTTACAACCAACAGTAATGACATACAACATGTTGATCAATGCATATGCGAGGGGAGGTCAAGAATTAAGGTTGCCACAGCTTTTGAAGGAGATGG
CAGCACTTAATCTAAAACCTGATTCTATTACATATTCCACAATGATATATGCCTTCATCCGTGTGCGGGATTATAAGAGGGCATTTTATTTTCAT
AAGCAGATGGTAAAAAACCGGCAAGTGCCTGATGCTGAATCATATGAGAAGCTACGGGCAATTCTGGATGTAAAAGCTGCCATAAAGAACAGGAA
GGATAAAAGTGCTTTAATGGGAATAGTTAGAAGCAGTATGGGCTTATTGAAAGAAAAGAAAAAGGGAAAGAAGGATGAATTCTGGAAAAATAGAA
AAAAAGGATCGAGATTTCAAGGACAGTAGTAGCTATATTTTTTGTCTTTGTCATTACCTAATCAACTTTTCATGAGTTAGCTTAGAATTTTCCTA
TTTCTTTTGGGGGGTATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266474] SGN-U581736 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80446 [Download] [View] Facility Assigned ID: TGSAQ19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0093 Quality Trim Threshold: 12.5