Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E266770

Search information 
Request: 266770Match: SGN-E266770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49159Clone name: cLEI-7-E20
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266770Length: 460 bp (1042 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E266770 [] (trimmed) GAAAACTAAAAGATTCCAATCTGAAGGCAATGGCACCGGCAGCAGATGTGGAGGATGAGATTAAGGACGAGAAGAACCCTAGGCCTCTTGATGAA
GATGATATTGCTCTACTCAAGACTTATGGTTTGGGGCCTTATTCCACAAGCATAAAGAAATGTGAGAAGGAAATCAAGGAAATGGCAAAAAAAAT
AAATGATTTGTGTGGTATTAAGGAATCTGACACTGGGTTGGCTGTACCAAGTCAGTGGGATCTAGTTTCAGATAAACAGATGATGCAGGAGGAGC
AACCTCTTCAGGTGGCTAGGTGTACAAAGATAATTAGCCCCAATACTGAAGATGCAAAATATGTTATAAATGTCAAGCAAATTGCTAAGTTTGTT
GTTGGATTAAGTGATAAAGTTTCACCGACTGATATAGAAGAAGGCATGAGAGTTGGCGTTGATAGGAATAAATATCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266770] SGN-U570782 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80995 [Download] [View] Facility Assigned ID: TGSAZ34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5