EST details — SGN-E267249

Search information 
Request: 267249Match: SGN-E267249
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48490Clone name: cLEI-4-L5
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188839 [TUS-56-D21] Trace: SGN-T338446 EST: SGN-E537571 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C188839 [TUS-56-D21] Trace: SGN-T348788 EST: SGN-E547913 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267249Length: 562 bp (822 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E267249 [] (trimmed) TTGAATTCGCGTCATAAAGTCTCATATTGAGAGGTAAAATGCTCTCCTAATATACAAAGACAATTATGTATTCAGAAAAATTCGAATACAGAACA
TCTGATTAATGATGAAACCCCCCCGGCACCGACTCACACCCTCTCAAATCCACTATAAAAAAAACCCCAAATTGCCTTCTTTCAATAGTATACAC
TTATCAATATTCAACACAAATGCCTTCTTCGAAATTTGAACCAAATGATGACATATTTGATTTTGTAATCAAGAAAGCGAATGGACTAAAAGGCA
TAGCAGACACAAGCCTTGAAATTATCCCGAATCAATGCATTCAACCAGAAGAACATAGACTAGACAAATCCCAAATTGACAATCAAGAATCAATC
CCGACAATTGATCTGTCAAATTGTGATGATTTAAACATTGAAAAATCGATTCAAGAAGCAGCAAGCAAATGGGGTTTCTTTCAAATCATCAATCA
TGGGATCCCAATTGAAGTTCTTGAAGATTTGAAAGAAGCAGGACACAAGTTCTTTGAATTGCCAGCTGAAGAAAAAGCTAAGTATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267249] SGN-U562643 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80396 [Download] [View] Facility Assigned ID: TGSAO63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0153 Quality Trim Threshold: 14.5