Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E267289

Search information 
Request: 267289Match: SGN-E267289
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48517Clone name: cLEI-4-N14
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267289Length: 413 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E267289 [] (trimmed) AATTATTGTGAAAAAAAATCTAAAATTTGGTGTAAAAATGGCTGGAAATGGAGTATTTGCAGAAATAATTGATGGAGAAGTGTACAAATATTATT
GTGAAGGAGAATGGAAAAAATCAGCTTCTGGAAAATCTGTTGCTATTATTAATCCTACTACAAGAAAGACACAATACAAAGTTCAAGCATGTACA
CAAGAAGAGGTGAACAAAGTAATGGAAATAGCAAAAGCAGCACAAAAATCATGGGCTAAAACACCACTATGGAAAAGAGCAGAGTTACTTCATAA
GGCAGCTGCAATTTTGAAAGAACACAAAGCCCCTATTGCTGAATGCCTTGTTAAAGAAATTGCAAAACCAGCTAAAGATGCTGTCACCGAGGTTG
TGAGATCTGGTGATTTGGTTTCTTACACTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267289] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80436 [Download] [View] Facility Assigned ID: TGSAP79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0058 Quality Trim Threshold: 20.5