EST details — SGN-E267585

Search information 
Request: 267585Match: SGN-E267585
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49393Clone name: cLEI-8-B23
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267585Length: 458 bp (866 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E267585 [] (trimmed) GGCTAATACCAAAGACTCATACCACATAATTACAATGGATACCAAAGAATCTTCAATTCCAAGTCTTCCTATGAAAGAAATTCCTGGTGATTATG
GTGTCCCATTCTTCGGGGCGATAAAAGATCGTTACGATTTTCATTACAATCAAGGTGCTGATGAATTTTTCAGGTCTCGCATGAAAAAGTACGAT
TCCACTGTCTTTAGAACCAATGTCCCTCCTGGTCCTTTCAATGCTCGTAACTCTAAAGTTGATGACCTTGTAGACGCGGTTAGTTATCCCATCCT
TTTCGATAACTCCCAAGTCGACAAGGAAAACTACTTTGAAGGTACTTTTATGTCCTCTCCATCTTTCAATGGTGGTTATAAGGTTTGTGGTTTTC
TTGGTACTAGTGACCCTAAACACACCACTCTAAAAAGTTTTTTCTTGTCCACACTAACTAGATTGCATGACAAGGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267585] SGN-U566889 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81457 [Download] [View] Facility Assigned ID: TGSBE12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5