EST details — SGN-E267611

Search information 
Request: 267611Match: SGN-E267611
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49598Clone name: cLEI-8-N1
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188997 [TUS-56-K11] Trace: SGN-T338715 EST: SGN-E537840 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267611Length: 525 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E267611 [] (trimmed) CAAATATGGGAATATATCACAGGCATTTTCAGTATTGAATCACATGCTTGAAATAGGTCGACTGCCAAATGTTCAGCTTTATGGTATTCTTATCA
ATGCCCTCTCAAAGAATGGGAAATTGTCAGATGCCATGGATGTTTTATCTGAACTTTATAATAAGGGTCTAGTTCCTGATGTGTTCACTTACACC
TCACTAATTTCTGGCTTCTGTAAGCAGGGTAATTTGGAGAAGGCTTTTCTACTTCTTGATGAAATGAGTCAGAAAGGCGTTAGACCAAACATCGT
CACTTATAATAGCTTAATAGGTGGTCTTTGCAAGTCAGGTGACCTATCGAGAGCTAGGGAAGTGTTTGATGGTATCTCTGGAAAGGGTTTAGCAC
CAAATAGTGTGACATATACTACAATCATTGATGGTTACTGCAAAGCTGGTGATCTAAATGAGGCATTTTGCCTTTCAGATGAAATGCCTTTACGG
GGCGTTCAACCGGATGCCTTTGTATACAATGCTCTTCTTCACGGATGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267611] SGN-U582923 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81483 [Download] [View] Facility Assigned ID: TGSBE73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5