EST details — SGN-E267635

Search information 
Request: 267635Match: SGN-E267635
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49497Clone name: cLEI-8-H18
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188981 [TUS-56-J19] Trace: SGN-T338687 EST: SGN-E537812 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188981 [TUS-56-J19] Trace: SGN-T338690 EST: SGN-E537815 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267635Length: 374 bp (746 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E267635 [] (trimmed) CTCACAATTGAATTTACTCAAAGATTTAAAAGAGCAGAAATTGTTGAACAAACAAAGAAAACTAATTACTTTACATATCAATGAACTTGCATGAC
TATCAAGTACCTATGTTTTAAAGATTTTAAACCAAATCATCAAGCGTTCCATTAGCACAGAACAATAATTAACAGAACAACCGGTCAATCATCTT
TCCACAATCAAGATCTTTTTCCCTAACTTGCTTGGGATTGAGGCATAGTTGATGCAATACTATCTTCACCGAGTGTTCTCACGGCGTCTCACATA
ACGTGTACGGACGATATATATGGGTCTGTCTTGAGCTCTCTGGGGTACTGGCTCCACTCTCTTTAGTCTTTCAGGTGATCTTTGAACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267635] SGN-U576315 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81507 [Download] [View] Facility Assigned ID: TGSBF45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0236 Quality Trim Threshold: 14.5