Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E267875

Search information 
Request: 267875Match: SGN-E267875
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46292Clone name: cLEI-12-B17
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189080 [TUS-56-N22] Trace: SGN-T338857 EST: SGN-E537982 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189080 [TUS-56-N22] Trace: SGN-T338860 EST: SGN-E537985 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267875Length: 634 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E267875 [] (trimmed) TTTTTTTCACTCAGAAATCAAAATATCTGAAATTTCACTAGTTAAAAGTTTTAAAAGAAAACATTGCGTACTTGTCCTATACGATTATACCAATC
CCCCACAATTGAAAAGAAGAAGAAAAAACCCCGAATCTCCAATTATAGTAACACTCCACATTGGCCTATTGGGCCAAACAAACAAGACCAATTGA
ATTGTCACCACCACTTCCGGGCAACTTCCTCTTGGGCTTGGCCTCTTGTAACATGGACACAACATCCCTCATCGAAGGCCGGTCAGCCGGGTTCC
GGCTAGTACATAGCAACGCCACCCTAAGCATCAACATCATTTCCTCCCTCACTCGAGGACACGAAGCACCGATATTTTTATCCAAAATATCAGTT
ACACCGTTTTTAATCTTCATCTTGGACCTCACCCAATCCACAATGCTATTTCCATCGCCAAATTCCGAATCTACCGATCTTTTTCCCGATAAAAT
TTCCATTAACACCACTCCATAGCTATAAATGTCACTCTTTTCGTCCACTTGCAATGTATACGCGTATTCGGGTGCAATGTAGCCATAAGATCCAG
CAATGACGGACATCGATTCGTCGCATTCAATCAATTTAGCAACCCCAAAATCAGCAACCCTAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267875] SGN-U568415 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82294 [Download] [View] Facility Assigned ID: TGSBU09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5