Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E268113

Search information 
Request: 268113Match: SGN-E268113
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47300Clone name: cLEI-15-M11
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268113Length: 477 bp (739 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E268113 [] (trimmed) TTATTTTCATCCTTTCTCTCTCTACCTCAAACTTTCTCTTTCTAGATCTGGGATCCCTAAATTTCTCCTCATTTTCTCTTTACCATTTCTCTATT
CTCATTTTCATTCACCTTATTCCCTTTCCCCTCTTCTACAATTCTCTCTGAACTTTCCCTTTCGTAGAATTAGGGTTAGGGTTTCACCAAGAGAA
CCAAAGAAAACACCATTGGCATGTCTCGATTTTCTTCTCTGCTGGGTTTTCAAGCCATTCTGAAGAAACGACATTGAAAGGAATTGGAGAGGTTA
AAAGAAACGGAAACAAGAAGCTCCAAGATACCACATTTAATCTCTTTTTTTCTTTTTAAATTTTTTCTGGGATCAGGTCTTCTAAAGAAGATCTG
AAAAGAGGAGGGTTATTGTTGGTTTTCTGAATAGCCGGGAAAAATGAGTGCTTCAAGGTTTATCANATGTGTTACCGTCGGCGATGGTGCCGTTG
GA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268113] SGN-U581579 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83060 [Download] [View] Facility Assigned ID: TGSCE78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5