Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E268147

Search information 
Request: 268147Match: SGN-E268147
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47278Clone name: cLEI-15-K4
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189210 [TUS-57-D8] Trace: SGN-T339060 EST: SGN-E538185 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189210 [TUS-57-D8] Trace: SGN-T339063 EST: SGN-E538188 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268147Length: 461 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268147 [] (trimmed) AGTTCTCTTCATCAATGGCGGCAAAGAACGTAGCCCAATCAACCTTCCCACTCCAAGATCGTGTGGCCATTGTTACCGGTTCTTCTCGCGGAATC
AGCAAAGCAATTGCACTTCATTTGGCCTCACTTGGTGCTAAACTCGTCATCAACTATTCCTCCAACTCCACTCAAGCTGACGACGTCGTATACCA
GATCAATTCCACCTCCGGTTACCCACGTGCCATTGCGGTCAAGGCCAATATCTCAGATCCAGATCAAGTGAAATCCCTCTTTGACGCTGCTGAAT
CGGCTTTTCAATCGCCGGTCAACATCCTGGTAAACTCCGCCGGGGTACTCTACGGAAAATACCCGTCAATCCTAAACACAACCCTAGAGGATTTC
GACAGGACTTTTGATGTGAACGCTCGTGGAGCTTTCGTATGCTGCAAGGAAGGTGCTCAGAGAATCAAACACGGTGGAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268147] SGN-U571019 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83094 [Download] [View] Facility Assigned ID: TGSCF62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0209 Quality Trim Threshold: 14.5