EST details — SGN-E268156

Search information 
Request: 268156Match: SGN-E268156
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47345Clone name: cLEI-15-O4
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189217 [TUS-57-D15] Trace: SGN-T339072 EST: SGN-E538197 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189217 [TUS-57-D15] Trace: SGN-T339075 EST: SGN-E538200 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268156Length: 623 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268156 [] (trimmed) TCCTCTCTTGTGCAGTATCTTCTAAAGTTGAAATCTCGTATAGAAAAATGAAAGTACACTCCTGCATTCATCCTCTTCCCTCTACTCCCTCCACC
GGAATTTTGGTCTCTGCCGGTCCTGCGGAAGCTAAGCTTGCTGCTAACACCAGAAAGCTTTATTCTTTAACTTTGAATTCCTCTAATTATGTCCC
ATTTCCTTATAAAGATCAGAAATTTTCCAGAAGCAGCTCTACGGATTTTTCTAGAACGGCTATCGGTTCGAATGTAAGTGAAGATACAGATGACA
TGTTTGATGATCTCCTAAGAACGCATGGCAAAGTGGTATACAAAAGAAATGACCAAAAACCTGCAAGTGAGGAGATTGATGATGATGCTGAAAGC
CTATCGTTTGCAATGGCTGTGGCTAAAGTTGCAAGTGATGTCAAGGCTGGAGATATAAAGGTCCTCTTTGTCAAGCCTCTAGTATATTGGACTCG
GTTTTTCATTATTGCTACTGCATTCTCTCGCCCACAGATTGATGCCATTGGGACCAGAGTAAGAGATATGGCTGAGGAACAATATGGAAGAGTTG
CTTCTGGAGATTCAAAACCCAACTCGTGGACACTACTGGACTTTGGTGATGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268156] SGN-U566055 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83103 [Download] [View] Facility Assigned ID: TGSCF86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5