Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E268996

Search information 
Request: 268996Match: SGN-E268996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47496Clone name: cLEI-16-G8
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177674 is on microarray TOM1: SGN-S1-1-1.3.6.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177674 [TUS-27-C16] Trace: SGN-T182995 EST: SGN-E370620 Direction: 3' Facility: INRA
Clone: SGN-C177674 [TUS-27-C16] Trace: SGN-T182996 EST: SGN-E370621 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268996Length: 523 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268996 [] (trimmed) GGAGAGGGGTGCTAATGTGAAGAATGAGACTAGACCTAAGAACAGATAAAGAAGCAGATGGGCAATTGTGGTACTAGAGAAGAATCTGCTGTTGT
CTCCAATGCTCATCATCAAGTCCAGCAGCAGCAGGGGTTATCGTTGGGAAGCAGGATAGGTATTGATTCAAAGAAACATAGTCATAGTCGTTCTA
CATCAGATCTGAGTGATCCTTCGACTCCGAGAAACTTAGAGGATTTTAGAAAGAATGCTGTACTGTATACTCATATAATTGCATTTACTCTTTTT
GAGCTGGAGACAATTACTAAAAGCTTCCGATCTGATTATATACTTGGTGAGGGTGGTTTTGGAACTGTTTACAAGGGCTACATTGATGAGAATGT
TCGTGTTGGACTTAAGTCTTTGCCGGTTGCTGTCAAAGTACTTAACAAAGAGGGGCTTCAAGGTCACCGTGAGTGGCTTACTGAGGTCAACTTTC
TTGGACAGCTTAAGCATTCTAATCTTGTCAAGTTGATCGGGTATTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268996] SGN-U578571 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83220 [Download] [View] Facility Assigned ID: TGSCJ40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5