Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E269250

Search information 
Request: 269250Match: SGN-E269250
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47632Clone name: cLEI-16-N24
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177702 is on microarray TOM1: SGN-S1-1-5.4.6.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177702 [TUS-27-D20] Trace: SGN-T1459 EST: SGN-E378762 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177702 [TUS-27-D20] Trace: SGN-T193012 EST: SGN-E391686 Direction: 3' Facility: INRA
Clone: SGN-C177702 [TUS-27-D20] Trace: SGN-T193013 EST: SGN-E391687 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269250Length: 485 bp (1028 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269250 [] (trimmed) CTGCCGTCGACCACCGCACGCGACAGCAGTCCAACGGCAAACTCTCGTGGCTGGGCCCCTTCACTAAATCCATATTTCCGGCTAAGCGTCGGCTC
CGGCTTGATCCTTCTAACAATCTCTACTTTCCATATGAACCTGGAAAGCAGGCGAAGAGTGCCATAAAGATTAAGAACACAAGCAAATCTTTTGT
AGCATTCAAGTTTCAAACTACTGCACCAAAGAGCTGCTACATGCGACCTCCGGGAGGTATTCTTGTACCTGGGGAAAGTTTGATTGCCACTGTCT
TCAAGTTTATTGAACAACCTGAGAACAATGAGAAGCCTATAGATCAAAAGACCAAAGTAAAGTTCAAGATCATAAGTTTGAAGGTGAAAGAAGGA
ACTGATTATGTACCTGAGTTGTTTGATGAACAAAAGGATAAAGTCTGTATTGAGCGTACTCTAAAGGTGGTGTTCTTGGACCCTGAACGCCCTTC
TCCAGCACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269250] SGN-U581077 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83474 [Download] [View] Facility Assigned ID: TGSCL84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0163 Quality Trim Threshold: 12.5