EST details — SGN-E269331

Search information 
Request: 269331Match: SGN-E269331
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61639Clone name: cLEM-18-P9
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C171576 [TUS-11-E14] Trace: SGN-T352378 EST: SGN-E551503 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269331Length: 540 bp (931 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E269331 [] (trimmed) GAGGAAATGTCGGTCATGCTATGCAATTAGTTGATAAAATGGAGGAATATGGATATCCAACAAATACTGTGACTTACAATTCTCTTATAAGAGGA
CTTTGTATGAGGGGGAACCTGAACAAGAGCCTGCAATTTGTCGAAAAGTTGATTCAGAAAGGGTTGGTACCAAATGCATATACGTACTCTATATT
GCTTGAGGCTAGTTATAAAGAAAAAGGGGTTAATGAAGCAATGTTACTTTTAGACAATATTATTGCCAAGGGTGGAAAGCCTAATTTGGTTAGTT
ACAATGTTCTCTTAACTGGGCTGTGCAAAGAAGGAAGAATAGATGAAGCTAAACAATTCTTTAGAAACTTGCCATCAAAAGGGTTTAATCCTAAC
GTTGTCAGCTATAATATCTTGTTGAGGAGCTTGTGTTTTGAAGGACGTTGGGAAGAAGCGAATGAGTTTCTGGCAGAGATGGTTGGAGAAGATCG
TTCTCCATCGATTGTAACGTACAATATATTGATCAGTTCGCTTGCTCTTCATGGGCAAACGGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269331] SGN-U567406 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86127 [Download] [View] Facility Assigned ID: TGFCS89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5