EST details — SGN-E269841
Search information |
Request: 269841 | Match: SGN-E269841 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C61412 | Clone name: cLEM-17-K22 |
| ||
Library Name: cLEM | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit
Development Stage: immature green fruit
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E269841 | Length: 208 bp (864 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E269841 [] (trimmed)
GAGAATTCTGCACGAGGCATCAACAAGTGTTGGTTCTAGTGGATTGGGCCACTCAACCCTCCCTCAATCTTACGTTCTACCTGAATCTTAAAGAC
CTTGCATGTATGAAGTTGTTGATAGCGACGATCTTGTCCCAGTCATTGATATGTCTTGTACTGATAGGAACGTTATCGTTCATCAAATCGATGAA
GCTTGTCTTCTTTATGGG
CTTGCATGTATGAAGTTGTTGATAGCGACGATCTTGTCCCAGTCATTGATATGTCTTGTACTGATAGGAACGTTATCGTTCATCAAATCGATGAA
GCTTGTCTTCTTTATGGG
Unigenes |
Current Unigene builds | |||||
[SGN-E269841] | SGN-U576121 | Tomato 200607 | Build 2 | 8 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T85983 [Download] [View] | Facility Assigned ID: TGFCN71TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.964 | Expected Error Rate: 0.0357 | Quality Trim Threshold: 14.5 |