EST details — SGN-E269902

Search information 
Request: 269902Match: SGN-E269902
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61453Clone name: cLEM-17-N10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189363 [TUS-57-J17] Trace: SGN-T339292 EST: SGN-E538417 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189363 [TUS-57-J17] Trace: SGN-T339294 EST: SGN-E538419 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269902Length: 447 bp (623 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269902 [] (trimmed) TTTCTGAAGACTTGTTTTGTGTTCACATTGGGAAGATATGAAAGGGTAAAGGGGGTTAAAAAAAGCATATTCTTGATTATTTTTTTGGTTACCCT
TCTTGGAATGGAGCTGAAGAAGGAGAGGTTTGTAAGGTTCTACTCTGGTGAAAAGCAACATGGTAGTTTTTTGGGAGGAATAGCATACAGTTCGA
ACGTAGAGAAAAAATTCTCACCTCCATTATTGAACTCTGATGGAAAATATAAAGTCGCTGATACTCTTAAGTTTGGGAGGCCGAACAAGGTGTAT
CCCGAGGACCATGAGTCCTGGAGGAAGCGAATACTTTATCCGGGGAGTGACCTTGTAATCCAGTGGAATAGAATTTTTATTATATCATGCTTGCT
GGCACTGTTTGTTGATCCAATTGTATTTTTTTTTGCCCATCATACAATGGACGAAAGAATCGAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269902] SGN-U563693 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86044 [Download] [View] Facility Assigned ID: TGFCP77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0239 Quality Trim Threshold: 14.5