EST details — SGN-E270210

Search information 
Request: 270210Match: SGN-E270210
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62204Clone name: cLEM-1-M6
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189281 [TUS-57-G7] Trace: SGN-T339168 EST: SGN-E538293 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270210Length: 394 bp (721 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270210 [] (trimmed) TTCAAGAATAACAAGAGGGCTTTGCCTGAGGATGAAGATTGTGAATCAAACTCCATTTCAGATCCCAAAACTCCACCTGTTGCCAAGACACAAAT
AGTAGGGTGGCCACCAGTAAGAGCTAACAGGAAAAATAGCTTTCCATCAAAGAAAGCAGAAGCTGAATGTGGGATGTATGTGAAAGTTAGTATGG
ATGGAGCCCCTTATCTTAGAAAAATTGATCTGAAATTGTACAAGGGTTATCCAGAACTGTTGAAGGCATTAGAGAAAATGTTCAAGCTGAGTATC
GGTGAATATTCAGAAAGGGAAGGGTATAAAGGGTCTGAATTTGCTCCTGCTTATGAAGATAAAGATGGTGACTTGATGCTTGTTGGAGATGTTCC
TTTTGAGTAAGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270210] SGN-U579749 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83583 [Download] [View] Facility Assigned ID: TGFAB75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0308 Quality Trim Threshold: 14.5