Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E270369

Search information 
Request: 270369Match: SGN-E270369
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61989Clone name: cLEM-1-B5
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177721 is on microarray TOM1: SGN-S1-1-2.1.6.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177721 [TUS-27-E15] Trace: SGN-T182854 EST: SGN-E371346 Direction: 3' Facility: INRA
Clone: SGN-C177721 [TUS-27-E15] Trace: SGN-T182855 EST: SGN-E371347 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270369Length: 557 bp (835 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270369 [] (trimmed) GATCTTAGAAGGGTTGCTGGCTTCCGTACAGTCCCGGTTGAGGTCGGAAAGAACTATTTGTGCCCAGAATGGAAGCAAGAGCTGATCACTTTTTC
TGAATTTCTTGAGAGGATACGGTCCAATGATACTACCTCTGTGGAAACTACGTACTTAGCTCAGCATCAATTATTTGATCAGTGGCTTAGCTCTG
TAGCTAAATGACAGATACAAGAGCTACAACAAGATATTGTTATTCCTGATTATTGTTTTACTGGAGGTGGGGAAATTAGGTCGCTTAATGCTTGG
TTTGGTCCAGCCGGGACTGTGACGCCTTTGCATCATGATCCGCACCATAACATACTTGCTCAGGTTGTTGGCAAAAAGTATGTACGGCTTTACTC
TGCATCACTTTCGGATGAGCTTCACCCACATAGTGAAACCATGCTTAGTAATTCCAGCCAGGTTGATCTAGACAACATTGACGAGAAAGAGTTCC
CAAATATATTAGACCTCGAATTCCAGGACTGTATTTTAGAGGAAGGTGAAATGCTTTACATCCCCCCTAAATGGTGGCACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270369] SGN-U576054 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83742 [Download] [View] Facility Assigned ID: TGFAC03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5