EST details — SGN-E270381

Search information 
Request: 270381Match: SGN-E270381
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62148Clone name: cLEM-1-J9
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177775 is on microarray TOM1: SGN-S1-1-4.3.6.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270381Length: 638 bp (841 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270381 [] (trimmed) GGAGAAGTATGGGTGTGGACTATTACAAGGTTCTTCAGGTGGACCGAAATGCCAAAGATGATGACCTCAAAAAAGCCTATCGAAAACTCGCTATG
AAATGGCATCCTGATAAGAACCCTAACAACAAGAAAGAAGCTGAAGCCAAATTCAAACAAATCTCTGAAGCCTACGATGTTTTGAGTGATCCACA
GAAGAGAGTAGTGTATGATCAATACGGAGAAGAGGGGTTGAAAGGGCAGGTGCCACCTCCAGGTGCCGGTGGATTTTCTGGCCCTTCAGATGGGG
GTGGTCATGGGTCGTTTCGATTCAACCCCCGTAGTGCTGATGATATATTCTCCGAATTCTTTGGGTTTTCCACCCCGTATGGTGGGATGGGAGAT
ATGGGTGGACGGGCTGGTGGTCCAAGTTTCAGTAGAGGTATGTTTGGGGAAGATATTTTCACTTCATTCAGGAATGCTGCTGGCGAAGGTGCATC
AGGTAATGCTCCACGAAAGGCCGCTCCTATAGAGCGGGCACTTCCTTGTAGTTTGGAGGATCTATACAAGGGAACCACCAAGAAGATGAAGATAT
CCAGAGAAGTTACTGATGCTACTGGGAGACCCAGTACAACAGAGGAAATTCTAACGATTGATATCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270381] SGN-U569323 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83754 [Download] [View] Facility Assigned ID: TGFAC53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5