EST details — SGN-E270382

Search information 
Request: 270382Match: SGN-E270382
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62182Clone name: cLEM-1-L3
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C182489 is on microarray TOM1: SGN-S1-1-2.4.8.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270382Length: 634 bp (836 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270382 [] (trimmed) GGAGTTTCTCATTCTACTTCTATAATGGCTACTTCTACCATGGCTCTTTCTTCCTCTACATTTGCCGGAAAGGCGGTTAAACTCTCCCCATCTTC
TTCTGAAATCACCGGAAATGGGAGAGTCACCATGAGGAAGACTGCTACCAAGGCCAAGCCAGCCTCCTCTGGTAGCCCATGGTATGGTCCTGACC
GTGTTAAGTACTTGGGACCATTCTCTGGGGAATCCCCAAGCTACTTGACCGGTGAGTTTCCTGGTGATTACGGATGGGACACTGCTGGACTTTCA
GCTGACCCTGAAACATTCGCTAAGAACCGTGAGTTGGAGGTTATTCATTGTAGATGGGCCATGCTTGGTGCTCTTGGATGTGTATTCCCCGAGCT
TTTGGCCCGTAATGGTGTTAAGTTCGGTGAAGCTGTATGGTTCAAGGCTGGATCACAAATTTTCAGCGAGGGTGGACTTGACTACTTGGGAAACC
CAAGCTTGGTCCATGCACAAAGCATTTTGGCTATCTGGGCTTGCCAAGTTGTGTTGATGGGAGCCGTTGAGGGTTACCGTATTGCTGGTGGGCCT
CTTGGTGAGGTTGTTGACCCACTCTACCCTGGTGGTAGCTTTGACCCACTGGGCCTTGCTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270382] SGN-U579181 Tomato 200607 Build 2 140 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83755 [Download] [View] Facility Assigned ID: TGFAC62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5