Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E270413

Search information 
Request: 270413Match: SGN-E270413
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62088Clone name: cLEM-1-G9
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177756 is on microarray TOM1: SGN-S1-1-7.3.6.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270413Length: 500 bp (1217 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270413 [] (trimmed) TCTCCAAAGCATTGCATTACATCAACTGTGGTGAAGGAAGGAAGGTAATGGATCATCAACAGGAGCAGGATCCTCCAACATTCAACAGTAAATCA
CTTGAGAAGAAGCCAGGAATTCTCTTTATTGGATCTCCCAATGTCGGCAAACGCGCCCTTATCTCTCGACTACTTTCAGTAGATTCTGAAGATGC
ATTTGAATCATCTTCTAACATCCTATCATATCCGTGGGCAATCAACACCAAGTATTATAATGCTGATGTTTCTGTTTGGATGGCCCATCTTCATG
AGGACTTCTCCATTGGAGCCCTGCCAGCATATGATCAGCTTGTTGCATTGGTGATGGTCTTTGACGTTACTGATCTCTCATCTTTTGTTGCGCTT
AAAGATTTTGTCTCCCGCACTGACATCCTCAAGTTTGAGATTTTGTTATGCATTGGCAACAAAGTGGACCTTCTTCCTGGTCATTCGGCTCATGT
TGAATACAGGCAGCTCCTGTTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270413] SGN-U573824 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83786 [Download] [View] Facility Assigned ID: TGFAA41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0092 Quality Trim Threshold: 20.5