Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E270493

Search information 
Request: 270493Match: SGN-E270493
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67622Clone name: cLEN-1-C5
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67622 [cLEN-1-C5] Trace: SGN-T87799 EST: SGN-E270494 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270493Length: 253 bp (952 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270493 [] (trimmed) GTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTAAAGT
ACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGATGAGG
ATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGGAGAAATGGGGTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270493] SGN-U577171 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87798 [Download] [View] Facility Assigned ID: TRRAA15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5