Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E270615

Search information 
Request: 270615Match: SGN-E270615
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64428Clone name: cLEM-6-C1
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178022 is on microarray TOM1: SGN-S1-1-5.2.4.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178022 [TUS-28-B4] Trace: SGN-T183687 EST: SGN-E370755 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270615Length: 607 bp (986 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270615 [] (trimmed) TCCATTTTCCGTCTGCCGGAGAAAAATGAAGCTCCGAGCAGCAGCAACAACTCTGATTATTATTCTCTTTGCCGCTATTCTGCCATGTCACAGTC
AGATCAGTAAAACCAAGCCGTCGCTATCTGCAAAAGGAGAAGCACCAGCTGCAGCAATCAGTATCATATCTCTAATGTCAGCTCATGGATGTAAA
AGTTTTGCAGATACACTATCAGGTTCACCGGCTGAGAAGACATTCGAGGACAATGTAGAAGGAGGTGTAACAATATTTTGTCCAACAGACGATGC
AATGAAATCGTTTTCACCTAAATTCAAAAATTTAACAGCGGATGGAAAACAATCAGTTCTCGAATATCATGGAGTTCCGGTTTATCAATCGATGT
CGAGTTTGAGAACGAGTAATGGTTTGATGAACACTTTAGCTACTGATGGAGCTAATAACTACGATTTCGTTGTTCAAAATGACGGACAAGATGTG
ACATTGAAGACTAAAATAGTTACAGGGAAAATCACTGGAACTGTATTTGATAAAGAGCCAGTTGCGATTTTCTCGATTGATGAAGTTTTAGAGCC
AATCGAATTGTTCAAATTAGCTCCAACTTCTGCACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270615] SGN-U579149 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84371 [Download] [View] Facility Assigned ID: TGFAU13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5