EST details — SGN-E270652

Search information 
Request: 270652Match: SGN-E270652
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64657Clone name: cLEM-6-M21
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180888 is on microarray TOM1: SGN-S1-1-3.1.17.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180888 [TUS-35-I14] Trace: SGN-T193637 EST: SGN-E392311 Direction: 5' Facility: INRA
Clone: SGN-C180888 [TUS-35-I14] Trace: SGN-T193878 EST: SGN-E392552 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270652Length: 546 bp (983 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270652 [] (trimmed) GAAAATACAAAACCCCACTTCCCCTTTTCACTTTTGCTCACTCTAAGAGCATCTAAATCAACCTTAAGAGCTGTTACAATGTCGTATGATAAAGA
ACTTGATGCTGCCAAGAATGCTGCTTCTCTTGCTGCTCGCCTTTGTCAAAAAGTCCAAAAAGCACTGTTGCAAGCAGATGTTCAATCAAAGTCTG
ACAAATCTCCAGTGACGGTGGCTGATTATGGCTCACAGGCCGTGGTTAGCGTTGTTTTGCAGAAAGAGTTGTGTTCTGCTTCATTTTCATTAGTG
GCTGAGGAGGACTCTGGAGACCTTCGTAATGAAGAGGGAAAATCAACATTACAGCGTATCATGAAGCTTGTCAATGAAACACTTGCTAGTGATGG
AACATATGGTACTGCCCCATTATCTGAAGAAGATGTCCTTGCTGCCATTGATAGTGGTAGATCTGAAGGGGGTCCTTCTGGTCAGCACTGGGTGT
TGGATCCTATTGATGGTACTAAAGGGTTTCTAAGGGGAGACCAATATGCAATTGCATTGGGATTGCTAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270652] SGN-U566298 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84408 [Download] [View] Facility Assigned ID: TGFAU83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5