EST details — SGN-E270770

Search information 
Request: 270770Match: SGN-E270770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64683Clone name: cLEM-6-N4
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178180 is on microarray TOM1: SGN-S1-1-7.4.4.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178180 [TUS-28-H18] Trace: SGN-T183714 EST: SGN-E370782 Direction: 3' Facility: INRA
Clone: SGN-C178180 [TUS-28-H18] Trace: SGN-T183715 EST: SGN-E370783 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270770Length: 610 bp (907 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270770 [] (trimmed) GGAGAAGAGCACTAATGCCTTATACTGCTACACTTCTTGGATTCTATAGAGAAAATGGAGAAGATGCAGATTTGCAATTGGCTGGAACTGTGGAA
GTGTGTTTTGACAAAAGGGGTGCTAATGCTAATTCTCCCACACCTACACCTCCCAAGAACTCTCCATACATTTGCAATATGACAGTAGATAAGCT
GCTTAGGAGAAGGGGCATAGGTTGGCATCTGTTGAAAGCAAGCGAGGAACTAATTTCTCAAATGAGTTCTTCTAGAGAGGTTTACTTGCACTGTC
GAATGATTGATACTGCTCCACTCAACATGTATAGAAAAGCTGGATATACCATTGTTGAGACAGACAACATTTTTATCTTGTTGGCATTGCAGCGA
CGGAAGCACTTGATGTGGAAAGTCCTTCCAGATTCAGAAAGCCTTTCTGAAGTTGATGAATGCACTTCTTCAGTAGACACGTGAACATGTAAACA
TAGACAAGTTTTGAGGTGGATTCTGGTCTTCGATTTGCCAATATTCTACAGGTTTATATATCCCTGAAAACAATCATGTTGAACTTTATAACATG
CAGAAGCTATATGCAACTCTGTGAAGTAATATGATGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270770] SGN-U575582 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84526 [Download] [View] Facility Assigned ID: TGFAX74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5