Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E271164

Search information 
Request: 271164Match: SGN-E271164
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62770Clone name: cLEM-22-P10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271164Length: 457 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271164 [] (trimmed) TCAAGTATGCCTGGGTTCTTGACAAGCTCAAGGCTGAACGTGAACGCGGGATCACTATTGATATTGCCTTGCGGAAGTATGAGACTACCAAGTAC
TATTGTACTGTCATTGATGCTCCTGGTCATAGGGATTTCATCAAGAACATGATTACTGGTACCTCTCAAGCTGACTGTGCTGTCCTGATTATCGA
CTCCACGACTGGTGGTTTTGAAGCTGGTATCTCTAAGGATGGACAGACTCGTGAACATGCGTTGCTTGCTTTCACACTTGGTGTTAGGCAAATGA
TTTGTTGCTGCAACAAGATGGATGCTACCACACCTAAGTACTCCAAGGCTAGGTATGATGAAATTGTGAAGGAAGTGTCTTCTTACCTTAAGAAA
GTTGGTTACAACCCTGACAAGATCCCATTTGTGCCGATTTCTGGTTTCGAAGGAGATAATATGATTGAGAGATCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271164] SGN-U580191 Tomato 200607 Build 2 66 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87021 [Download] [View] Facility Assigned ID: TGFDJ89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0131 Quality Trim Threshold: 20.5