EST details — SGN-E271342

Search information 
Request: 271342Match: SGN-E271342
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64111Clone name: cLEM-5-C21
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177841 is on microarray TOM1: SGN-S1-1-2.2.6.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177841 [TUS-27-J15] Trace: SGN-T1470 EST: SGN-E378538 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177841 [TUS-27-J15] Trace: SGN-T183163 EST: SGN-E370926 Direction: 3' Facility: INRA
Clone: SGN-C177841 [TUS-27-J15] Trace: SGN-T183164 EST: SGN-E370927 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271342Length: 486 bp (1050 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271342 [] (trimmed) GGTCGACTCTGGAAAGTCTACTACCACTGGTCACTTGAGCTACAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTCGAGAAGGAAGCTG
CTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAAGGCTGAACGTGAGCGTGGTATCACTATTGATATTGCTTTGTGG
AAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGGACACAGGGACTTTATCAAGAACATGATCACTGGTACCTCCCAGGCTGA
CTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTCGAAGCTGGTATCTCAAAGGATGGTCAGACCCGTGAACATGCATTGCTTGCTTTCA
CCCTTGGTGTCAAGCAAATGATCTGCTGCTGTTACAAGATGGATGCTACCACCCCAAAGTACTCAAAGGCTAGGTATGATGAAATCGTGAAAGAA
GTTTCTTCCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271342] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85147 [Download] [View] Facility Assigned ID: TGFAQ23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5